Sunday, 23 April 2017

Voyage à Terango



Voyage à Terango
(en bande avec de vieux potes)



Vingt heures de temps terrestre durant, le « Dragon de Feu » de Terango fendit d’un trait lumineux l’obscurité silencieuse de l’infini…
A son bord, aucune présence vivante n’était plus apparente et seuls d’étranges robots à la mémoire artificielle mais infaillible surveillaient un cap connu d’eux seuls...
- Eddy Paape & Greg, Le maître de Terango, 1971, p .16



Eddy Paape & Greg, Luc Orient, éditions du Lombard, Bruxelles (18 albums entre 1969 et 1994)


  « Luc Orient » est une des plus anciennes séries de bande dessinées de mon enfance. J’en ai découvert les histoires en feuilleton dans le Journal de Tintin, dès le début (« Les Dragons de feu », 1969) et ce de manière régulière jusqu’à mes quatorze-quinze ans (« La Forêt d’acier », 1973). Il m’est arrivé par la suite d’en acheter les premiers albums, de les perdre et d’en racheter la série intégrale il y a une vingtaine d’années. Mes préférés restent les premiers albums du cycle de Terango (des « Dragons » à la « Forêt d’acier »). J’ai d’ailleurs eu du mal à reconnaître le style graphique d’Eddy Paape vieillissant dans les derniers albums, le personnage de Luc Orient y ressemblait à un athlète au corps bouffi par les hormones. Le style des premiers albums était beaucoup plus proche de la ligne claire agréable aux yeux et à l’esprit que l’excès de chairs baroques des titres de la fin.
  Il s’agit de science-fiction ancienne, qui supporte très bien l’épreuve du temps, construite sur le modèle des aventures de Buck Rogers, Flash Gordon et autres héros d’antiques « opéras de l’espace » des Princes des Etoiles. Dans mes souvenirs, les images de la planète Terango se superposent aux illustrations de Jean-Claude Forest, le père de Barbarella (1962) et créateur de couvertures superbes pour le magazine Fictions. L’album central du cycle de Terango, « Le maître de Terango » est celui dont je garde le souvenir le plus vif. J’avais été impressionné par les uniformes d’inspiration romantique des gardes noirs de Sectan, l’usurpateur tyrannique de la civilisation de Terango qui ambitionnait de subjuguer toutes les planètes avoisinantes à commencer par la Terre, par leurs armes qui tiraient des boules de foudre, par la nature foisonnante aussi, à l’allure mésozoïque, des paysages sauvages de la planète, hors les murs de la cité orgueilleuse de Terangopolis, par tout cet attirail de la bande dessinée des années ’60-70 qui reflétait la croyance à un progrès technique couplé au progrès humaniste des civilisations.
  Le professeur Hugo Kala, « cerveau » des aventures et patron de Luc Orient aux laboratoires d’Eurocristal 1 qu’il dirige, incarne à la perfection le prototype du savant idéaliste épris de justice. Est-ce qu’un personnage pareil « parle » encore aux jeunes gens de l’époque? Quand je parcours les BD récentes destinées aux adolescents, je trouve que la violence y est beaucoup plus crue et explicite et je ne suis pas certain qu’on y trouve souvent des personnages désintéressés. Une tendance que je trouve assez troublante dans le paysage actuel de la bande dessinée d’aventures, réside dans le nombre élevé de séries uchroniques consacrées à l’Allemagne nazie, séries qui mettent plus ou moins en œuvre des univers dans lesquels l’Axe a remporté la victoire ou bien d’autres univers dans lesquels la guerre se poursuit impitoyable après 1945 (Bloc 109, Das Reich, Les divisons de fer, Jour J, Wunderwaffen, Space Reich, USA über alles, WW2.2, U-BOOT…)
  En somme, les angoisses et peut-être aussi les fascinations morbides de l’époque présente, se reflètent-elles de manière beaucoup plus explicite à travers l’uchronie, qui est en passe de devenir un des genres dominants de la science-fiction, du moins dans le domaine de la bande dessinée, que dans des récits de space opera peut-être passés de mode.
  Les différentes visions du futur constituent à ce titre un des meilleurs indicateurs pour éprouver l’imaginaire des époques passées. La SF est-elle condamnée alors à n’être qu’un alibi pour imaginer nos « futurs antérieurs » possibles ?
  Il y a plus de quarante ans, la vision du futur était progressiste et positive, confiante. Aujourd’hui elle serait plutôt à dominante catastrophiste et les utopies se réfugient dans des passés alternatifs (des uchronies), mais qui sont le plus souvent de caractère négatif, des dystopies, de mauvaises utopies.
  Il faut peut-être juste oser se réveiller du cauchemar et penser qu’un avenir positif est possible, ce qui revient à penser le changement.

« La liberté de Terango dépendra de votre mission ».
Le maître de Terango, p. 46

En prime, quelques cases ou strips de l'album pour votre plus grand plaisir...








Monday, 17 April 2017

Quantitatif



Quantitatif
(chasse aux nucléotides)


Regarde l’œuvre de Dieu : qui pourra redresser ce qu’il a courbé ?
Ecclésiaste 7 :13




Director Josef: You keep your work station so clean, Jerome.
Vincent: It's next to godliness. Isn't that what they say?
Director Josef: Godliness. I reviewed your flight plan. Not one error in a million keystrokes. Phenomenal. It's right that someone like you is taking us to Titan.
Vincent: Has the committee approved the mission? There's been talk of delay.
Director Josef: You shouldn't listen to talk. You leave in a week. You've got a substance test.
- Incipit du film Gattaca, Andrew Niccol (dir.), 1997

  Children of God or engineered children? After all, we're made of stardust and some of us seem to remember it more, much more, up to the point of no-return...
  To move further along the beautiful line of this movie seen for the fourth of fifth time since 1997 - twenty years ago and not a single trace of dust - let the waves of chords move your heart, your bleeding heart with Michael Nyman's melancholic music.
  This is the full original 50' soundtrack of Gattaca with Ethan Hawke, Uma Thurman and Jude Law.


La séquence nucléotidique d’un ADN viral, févr. 1978
La structure tridimensionnelle de l’ARN de transfert, mars 1978
La génétique du cancer chez l’homme, avr. 1978
Le premier rétrovirus humain, févr. 1987
La structure du virus de la poliomyélite, mai 1987
La régulation des gènes, oct. 1991
(extrait de l’Index thématique à la rubrique « Génétique » du magazine Pour la Science)

Initial sequencing and analysis of the human genome, Nature, vol. 409, 15 february 2001



  La séquence GATTACA existe-t-elle dans le génome humain ?
 The human genome contains about 3 billion nucleic acids, which means that the sequence GATTACA probably occurs in the human genome about 180,000 times.


  Résumé du Gène AK105331 sur le chromosome 1 d’Oryza sativa
AACCATAATAAGTAATTGCGCACTAGGCCCCAATCCCCCCTCCCTGCGCCATACCATATTTAATGCATTCCTGTCGTGCTCATTACGTAATCTCGCACCCACGCAAAAAGAATATGCAAATGCGTGGGAGGATTTTTACTACAAACCCATGCATCGTCAACGAGAAGGGGCGCGCGCGCCACCACGTAGATTATCAGAAACAACCACGTATACTTCAACTTTATTATAAAAAAAACATACATATAGCGAAATGCCAAGGTACGTAGCAGCAGATTGTGGCCGTAGCAACGTAGCTCAAACGTTGGTCAATCCATGTGCAATTACATTACCTAGTAAAATAAAAGGTAAAAAAAATGCCAATCCCAAACGGCACAGGCGCACAGCATTTGAATATTACGGTTTAGAATAATCCCCAACACGGCTCATCCCAACCCGTACGGAACAGCTTGACAACAGCAGAGTACGCGCCACTCGTGTGTACAACCCCCGGGTGACCCAAGCCACGCACGCCAACGACGACAGCGCCACCTGTCACAGAAGAATCTCCCTACCCCCTGTCACTGCCATGTGGGCCCATGACGCGCGGCCACCACCAAACCACCACCATCCCGACCAATCAAACGGAGACGAGGCGACGGCGACGACAGCGACAGCGCCGTGGCAGTATACTCCTTGCCAGTAGAAGCATCCGAGACGTGACGTCACGTCACCCCGCCTTTACTCGCTTTCTCCGTTCTCCCTAGCCGCGTGAGCCGCGGTTTGCATCTCATCTTCACTCGCTTGCTCTCTCTTCCACCCGCTTTCCTCTTCCTCCTCGCCGCGCTTCCGCGTGGGCCCCCATCCCCGTTACCTATATATACCCCCCCCCTTCTCACCGTCTCCTTCCTCCCTCCAAGTCCAAGTGACCAACCATCATCAATCATCGCTAAGCCCACCTCGGAGATCTCGAGTTCGATCGTCGTCGTCGTAGCTGTAGAGGTAGTTAATTATCTCGTTTTAGATGAGCTCACTGACGGCGGCGCAGTTCCGGTCGCTGTTTGAGATGGCAGGAGGGGAGGATATCTCGTTTCTGTTTGGTGATGATGAGGCGGCGGCGGTGGCGGCGCCGGTGGAGTTGCAGGGGAAGAGGGGGTGGGAGGAGGTGGATCAAGGGGAGGGGTCTGGGGCGGTGGCGGCGAAGAGGCAGCGGTCGCCGACGAG

  Nucleotide sequence chromosome 1 Homo Sapiens (début de la séquence)


     aaccctaac cctaacccta accctaaccc taaccctaac cctaacccta accctaaccc        60

     taaccctaac cctaacccta accctaaccc taaccctaac cctaacccaa ccctaaccct       120

     aaccctaacc ctaaccctaa ccctaacccc taaccctaac cctaacccta accctaacct       180

     aaccctaacc ctaaccctaa ccctaaccct aaccctaacc ctaaccctaa cccctaaccc       240

     taaccctaaa ccctaaaccc taaccctaac cctaacccta accctaaccc caaccccaac       300

     cccaacccca accccaaccc caaccctaac ccctaaccct aaccctaacc ctaccctaac       360

     cctaacccta accctaaccc taaccctaac ccctaacccc taaccctaac cctaacccta       420

     accctaaccc taaccctaac ccctaaccct aaccctaacc ctaaccctcg cggtaccctc       480

     agccggcccg cccgcccggg tctgacctga ggagaactgt gctccgcctt cagagtacca       540

     ccgaaatctg tgcagaggac aacgcagctc cgccctcgcg gtgctctccg ggtctgtgct       600

  Une vue fonctionnelle du début du chromosome 1





Réduction du phénomène « vie »
codage d’informations physico-chimiques
nucléotides
Lettres
Mémoire morte

Déploiement du phénomène « vie »
traductions et groupements des informations
codes complexes et diversifiés
ADN ARN acides aminés
Protéines
Cellules Tissus
Organismes
Espèces
Mots, phrases, discours, langues
Mémoire vive



Annexe
(qui n'a rien à voir avec le sujet qui précède)
 Statistiques de fréquentation du blog MdC

 

 


 Il n'y a aucune corrélation entre la fréquentation du site et la quantité de billets produite par mois ( R2 est proche de zéro)