Quantitatif


Chasse aux nucléotides

Regarde l’œuvre de Dieu : qui pourra redresser ce qu’il a courbé ?
Ecclésiaste 7 :13


Director Josef: You keep your work station so clean, Jerome.
Vincent: It's next to godliness. Isn't that what they say?
Director Josef: Godliness. I reviewed your flight plan. Not one error in a million keystrokes. Phenomenal. It's right that someone like you is taking us to Titan.
Vincent: Has the committee approved the mission? There's been talk of delay.
Director Josef: You shouldn't listen to talk. You leave in a week. You've got a substance test.
- Incipit du film Gattaca, Andrew Niccol (dir.), 1997

  Children of God or engineered children? After all, we're made of stardust and some of us seem to remember it more, much more, up to the point of no-return...
  To move further along the beautiful line of this movie seen for the fourth of fifth time since 1997 - twenty years ago and not a single trace of dust - let the waves of chords move your heart, your bleeding heart with Michael Nyman's melancholic music.
  This is the full original 50' soundtrack of Gattaca with Ethan Hawke, Uma Thurman and Jude Law.


La séquence nucléotidique d’un ADN viral, févr. 1978
La structure tridimensionnelle de l’ARN de transfert, mars 1978
La génétique du cancer chez l’homme, avr. 1978
Le premier rétrovirus humain, févr. 1987
La structure du virus de la poliomyélite, mai 1987
La régulation des gènes, oct. 1991
(extrait de l’Index thématique à la rubrique « Génétique » du magazine Pour la Science)

Initial sequencing and analysis of the human genome, Nature, vol. 409, 15 february 2001



  La séquence GATTACA existe-t-elle dans le génome humain ?
 The human genome contains about 3 billion nucleic acids, which means that the sequence GATTACA probably occurs in the human genome about 180,000 times.


  Résumé du Gène AK105331 sur le chromosome 1 d’Oryza sativa
AACCATAATAAGTAATTGCGCACTAGGCCCCAATCCCCCCTCCCTGCGCCATACCATATTTAATGCATTCCTGTCGTGCTCATTACGTAATCTCGCACCCACGCAAAAAGAATATGCAAATGCGTGGGAGGATTTTTACTACAAACCCATGCATCGTCAACGAGAAGGGGCGCGCGCGCCACCACGTAGATTATCAGAAACAACCACGTATACTTCAACTTTATTATAAAAAAAACATACATATAGCGAAATGCCAAGGTACGTAGCAGCAGATTGTGGCCGTAGCAACGTAGCTCAAACGTTGGTCAATCCATGTGCAATTACATTACCTAGTAAAATAAAAGGTAAAAAAAATGCCAATCCCAAACGGCACAGGCGCACAGCATTTGAATATTACGGTTTAGAATAATCCCCAACACGGCTCATCCCAACCCGTACGGAACAGCTTGACAACAGCAGAGTACGCGCCACTCGTGTGTACAACCCCCGGGTGACCCAAGCCACGCACGCCAACGACGACAGCGCCACCTGTCACAGAAGAATCTCCCTACCCCCTGTCACTGCCATGTGGGCCCATGACGCGCGGCCACCACCAAACCACCACCATCCCGACCAATCAAACGGAGACGAGGCGACGGCGACGACAGCGACAGCGCCGTGGCAGTATACTCCTTGCCAGTAGAAGCATCCGAGACGTGACGTCACGTCACCCCGCCTTTACTCGCTTTCTCCGTTCTCCCTAGCCGCGTGAGCCGCGGTTTGCATCTCATCTTCACTCGCTTGCTCTCTCTTCCACCCGCTTTCCTCTTCCTCCTCGCCGCGCTTCCGCGTGGGCCCCCATCCCCGTTACCTATATATACCCCCCCCCTTCTCACCGTCTCCTTCCTCCCTCCAAGTCCAAGTGACCAACCATCATCAATCATCGCTAAGCCCACCTCGGAGATCTCGAGTTCGATCGTCGTCGTCGTAGCTGTAGAGGTAGTTAATTATCTCGTTTTAGATGAGCTCACTGACGGCGGCGCAGTTCCGGTCGCTGTTTGAGATGGCAGGAGGGGAGGATATCTCGTTTCTGTTTGGTGATGATGAGGCGGCGGCGGTGGCGGCGCCGGTGGAGTTGCAGGGGAAGAGGGGGTGGGAGGAGGTGGATCAAGGGGAGGGGTCTGGGGCGGTGGCGGCGAAGAGGCAGCGGTCGCCGACGAG

  Nucleotide sequence chromosome 1 Homo Sapiens (début de la séquence)


     aaccctaac cctaacccta accctaaccc taaccctaac cctaacccta accctaaccc        60

     taaccctaac cctaacccta accctaaccc taaccctaac cctaacccaa ccctaaccct       120

     aaccctaacc ctaaccctaa ccctaacccc taaccctaac cctaacccta accctaacct       180

     aaccctaacc ctaaccctaa ccctaaccct aaccctaacc ctaaccctaa cccctaaccc       240

     taaccctaaa ccctaaaccc taaccctaac cctaacccta accctaaccc caaccccaac       300

     cccaacccca accccaaccc caaccctaac ccctaaccct aaccctaacc ctaccctaac       360

     cctaacccta accctaaccc taaccctaac ccctaacccc taaccctaac cctaacccta       420

     accctaaccc taaccctaac ccctaaccct aaccctaacc ctaaccctcg cggtaccctc       480

     agccggcccg cccgcccggg tctgacctga ggagaactgt gctccgcctt cagagtacca       540

     ccgaaatctg tgcagaggac aacgcagctc cgccctcgcg gtgctctccg ggtctgtgct       600

  Une vue fonctionnelle du début du chromosome 1





Réduction du phénomène « vie »
codage d’informations physico-chimiques
nucléotides
Lettres
Mémoire morte

Déploiement du phénomène « vie »
traductions et groupements des informations
codes complexes et diversifiés
ADN ARN acides aminés
Protéines
Cellules Tissus
Organismes
Espèces
Mots, phrases, discours, langues
Mémoire vive



Annexe
(qui n'a rien à voir avec le sujet qui précède)
 Statistiques de fréquentation du blog MdC

 

 


 Il n'y a aucune corrélation entre la fréquentation du site et la quantité de billets produite par mois ( R2 est proche de zéro)
 

Commentaires

Posts les plus consultés de ce blog

Et si pas maintenant, quand ? Arendt et Heidegger, par Emmanuel Faye

De Clichy à Laeken